SIRT5 cDNA ORF Clone, Rabbit, N-HA tag - CD BioSciences

service-banner

SIRT5 cDNA ORF Clone, Rabbit, N-HA tag

SIRT5 cDNA ORF Clone, Rabbit, N-HA tag

SPD-13735

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rabbit sirtuin 5 with N terminal HA tag.
Target Information
Species Rabbit
Target Name SirT5
Gene Abbr. SIRT5
Gene ID 100339154
Full Name sirtuin 5
Introduction The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT5, a mammalian homolog of Sir2, is localized to the mitochondria and has been implicated in the regulation of cell metabolism. SirT5 deacetylates carbamoyl phosphate synthetase 1 (CPS1) in the mitochondrial matrix and increases its activity in response to fasting, allowing for adaptation to increased amino acid catabolism. SirT5 has also been shown to deacetylate cytochrome c in the mitochondrial intermembrane space. In addition to its deacetylase activity, SirT5 contains lysine desuccinylase and demalonylase activity. Succinyl-lysine and malonyl-lysine modifications occur in a variety of organisms and these post-translational modifications are found on many metabolic enzymes. Like phosphorylation of serine, threonine, and tyrosine residues, lysine succinylation and malonylation induces a change of two negative charges from a +1 to a -1 charge at physiological pH, and are thought to serve similar functions in the regulation of protein activity, protein-protein interactions, and protein stability. SirT5 knockout mice show increased levels of succinyl-lysine and malonyl-lysine protein modifications in the liver, including increased succinylation of CPS1, a known target of SirT5, suggesting that SirT5 functions to regulate metabolic enzymes through its deacetylase, desuccinylase, and demalonylase activities.
Product Details
Description Full length Clone DNA of Rabbit sirtuin 5 with N terminal HA tag.
NCBI Ref Seq XM_002714248.1
RefSeq ORF Size 933 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.