Online Inquiry
SIRT3 cDNA ORF Clone, Human, N-His tag
SPD-13692
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae), transcript variant 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SirT3 |
Gene Abbr. | SIRT3 |
Gene ID | 23410 |
Full Name | sirtuin 3 |
Alias | SIR2L3 |
Introduction | The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response and cell aging. SirT3, a mammalian homolog of Sir2, exists in human cells in two forms. The full-length 44 kDa protein localizes to the nucleus, while a processed 28 kDa protein lacking 142 amino terminal residues localizes exclusively to the mitochondria. The single murine form of SirT3 is equivalent to the processed human SirT3 protein. Full-length SirT3 protein is processed in the mitochondrial matrix by the mitochondrial matrix processing peptidase (MMP). Both full-length and processed forms of SirT3 are enzymatically active and de-acetylate histone H3 at Lys9 and histone H4 at Lys16 in vitro. SirT3 also de-acetylates Lys642 of acetyl-CoA synthetase 2 (AceCS2) and activates AceCS2 activity in the mitochondria. Restricted caloric intake, which is linked to increased lifespan in multiple organisms, increases SirT3 expression in white and brown adipocytes of obese mice, suggesting a role for SirT3 in aging. Two observations implicate SirT3 in the regulation of mitochondrial thermogenesis. First, exposure to cold temperatures increases SirT3 expression in brown adipocytes, while elevated temperatures reduce SirT3 expression. Second, over-expression of SirT3 results in increased levels of the mitochondrial uncoupling protein 1 (UCP1). SirT3 protein levels are also elevated in certain breast cancers. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae), transcript variant 1 with N terminal His tag. |
NCBI Ref Seq | NM_012239.5 |
RefSeq ORF Size | 1245 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | KpnI + XbaI (6kb + 1.25kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.