SIRT3 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

SIRT3 cDNA ORF Clone, Human, C-HA tag

SIRT3 cDNA ORF Clone, Human, C-HA tag

SPD-13689

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae), transcript variant 1 with C terminal HA tag.
Target Information
Species Human
Target Name SirT3
Gene Abbr. SIRT3
Gene ID 23410
Full Name sirtuin 3
Alias SIR2L3
Introduction The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response and cell aging. SirT3, a mammalian homolog of Sir2, exists in human cells in two forms. The full-length 44 kDa protein localizes to the nucleus, while a processed 28 kDa protein lacking 142 amino terminal residues localizes exclusively to the mitochondria. The single murine form of SirT3 is equivalent to the processed human SirT3 protein. Full-length SirT3 protein is processed in the mitochondrial matrix by the mitochondrial matrix processing peptidase (MMP). Both full-length and processed forms of SirT3 are enzymatically active and de-acetylate histone H3 at Lys9 and histone H4 at Lys16 in vitro. SirT3 also de-acetylates Lys642 of acetyl-CoA synthetase 2 (AceCS2) and activates AceCS2 activity in the mitochondria. Restricted caloric intake, which is linked to increased lifespan in multiple organisms, increases SirT3 expression in white and brown adipocytes of obese mice, suggesting a role for SirT3 in aging. Two observations implicate SirT3 in the regulation of mitochondrial thermogenesis. First, exposure to cold temperatures increases SirT3 expression in brown adipocytes, while elevated temperatures reduce SirT3 expression. Second, over-expression of SirT3 results in increased levels of the mitochondrial uncoupling protein 1 (UCP1). SirT3 protein levels are also elevated in certain breast cancers.
Product Details
Description Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae), transcript variant 1 with C terminal HA tag.
NCBI Ref Seq NM_012239.5
RefSeq ORF Size 1242 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.24kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.