SIRT2 Knockout Cell Line - CD BioSciences

service-banner

SIRT2 Knockout Cell Line

SIRT2 Knockout Cell Line

SPL-03205

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name SirT2
Gene Abbr. SIRT2
Gene ID 22933
Full Name sirtuin 2
Alias SIR2, SIR2L, SIR2L2
Species Human
Genomic Locus chr19:38893498
Transcript NM_030593
WT Expression Level 50.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Several transcript variants are resulted from alternative splicing of this gene. [provided by RefSeq, Jul 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of SIRT2.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence TCTGGGAGAATAAGTTCCGC
PCR Primer Forward: TTCAATAAATGGTTCAAGTGGCTGG
Reverse: AGTGACATCCAAAGTATGTAGCAGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.