Online Inquiry
SIRT2 Knockout Cell Line
SPL-03205
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | SirT2 |
Gene Abbr. | SIRT2 |
Gene ID | 22933 |
Full Name | sirtuin 2 |
Alias | SIR2, SIR2L, SIR2L2 |
Species | Human |
Genomic Locus | chr19:38893498 |
Transcript | NM_030593 |
WT Expression Level | 50.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Several transcript variants are resulted from alternative splicing of this gene. [provided by RefSeq, Jul 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of SIRT2. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCTGGGAGAATAAGTTCCGC |
PCR Primer |
Forward: TTCAATAAATGGTTCAAGTGGCTGG Reverse: AGTGACATCCAAAGTATGTAGCAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.