Sirt2 cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Sirt2 cDNA ORF Clone, Rat, N-HA tag

Sirt2 cDNA ORF Clone, Rat, N-HA tag

SPD-13651

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat sirtuin 2 with N terminal HA tag.
Target Information
Species Rat
Target Name SirT2
Gene Abbr. Sirt2
Gene ID 361532
Full Name sirtuin 2
Introduction The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae SIR2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT2, a mammalian homolog of Sir2, deacetylates α-tubulin at Lys40 and histone H4 at Lys16 and has been implicated in cytoskeletal regulation and progression through mitosis. SirT2 protein is mainly cytoplasmic and is associated with microtubules and HDAC6, another tubulin deacetylase. Deacetylation of α-tubulin decreases its stability and may be required for proper regulation of cell shape, intracellular transport, cell motility, and cell division. The abundance and phosphorylation state of SirT2 increase at the G2/M transition of the cell cycle, and SirT2 relocalizes to chromatin during mitosis when histone H4 Lys16 acetylation levels decrease. Overexpression of SirT2 prolongs mitosis, while overexpression of the CDC14B phosphatase results in both decreased phosphorylation and abundance of SirT2, allowing for proper mitotic exit. Thus, the deacetylation of both histone H4 and α-tubulin by SirT2 may be critical for proper chromatin and cytoskeletal dynamics required for completion of mitosis.
Product Details
Description Full length Clone DNA of Rat sirtuin 2 with N terminal HA tag.
NCBI Ref Seq FQ212805.1
RefSeq ORF Size 1056 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.