Online Inquiry
SIRT2 cDNA ORF Clone, Human, N-Myc tag
SPD-13671
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae), transcript variant 2 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SirT2 |
Gene Abbr. | SIRT2 |
Gene ID | 22933 |
Full Name | sirtuin 2 |
Alias | SIR2, SIR2L, SIR2L2 |
Introduction | The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae SIR2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT2, a mammalian homolog of Sir2, deacetylates α-tubulin at Lys40 and histone H4 at Lys16 and has been implicated in cytoskeletal regulation and progression through mitosis. SirT2 protein is mainly cytoplasmic and is associated with microtubules and HDAC6, another tubulin deacetylase. Deacetylation of α-tubulin decreases its stability and may be required for proper regulation of cell shape, intracellular transport, cell motility, and cell division. The abundance and phosphorylation state of SirT2 increase at the G2/M transition of the cell cycle, and SirT2 relocalizes to chromatin during mitosis when histone H4 Lys16 acetylation levels decrease. Overexpression of SirT2 prolongs mitosis, while overexpression of the CDC14B phosphatase results in both decreased phosphorylation and abundance of SirT2, allowing for proper mitotic exit. Thus, the deacetylation of both histone H4 and α-tubulin by SirT2 may be critical for proper chromatin and cytoskeletal dynamics required for completion of mitosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae), transcript variant 2 with N terminal Myc tag. |
NCBI Ref Seq | NM_030593.1 |
RefSeq ORF Size | 1059 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.