Online Inquiry
SIRT1 cDNA ORF Clone, Human, C-FLAG tag
SPD-13633
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human sirtuin 1 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SirT1 |
| Gene Abbr. | SIRT1 |
| Gene ID | 23411 |
| Full Name | sirtuin 1 |
| Alias | SIR2, SIR2L1, SIR2alpha |
| Introduction | The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae SIR2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT1, the mammalian ortholog of Sir2, is a nuclear protein implicated in the regulation of many cellular processes, including apoptosis, cellular senescence, endocrine signaling, glucose homeostasis, aging, and longevity. Targets of SirT1 include acetylated p53, p300, Ku70, forkhead (FoxO) transcription factors, PPARγ, and the PPARγ coactivator-1α (PGC-1α) protein. Deacetylation of p53 and FoxO transcription factors represses apoptosis and increases cell survival. Deacetylation of PPARγ and PGC-1α regulates the gluconeogenic/glycolytic pathways in the liver and fat mobilization in white adipocytes in response to fasting. SirT1 deacetylase activity is inhibited by nicotinamide and activated by resveratrol. In addition, SirT1 activity may be regulated by phosphorylation, as it is phosphorylated at Ser27 and Ser47 in vivo; however, the function of these phosphorylation sites has not yet been determined. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human sirtuin 1 |
| RefSeq ORF Size | 2283 bp |
| Sequence Information | The translated amino acid sequence is identical with NP_036370.2 |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 0.43kb + 1.87kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.