Online Inquiry
SIGMAR1 Knockout Cell Line
SPL-03195
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
80bp deletion |
Target Information | |
---|---|
Target Name | SIGMAR1 |
Gene Abbr. | SIGMAR1 |
Gene ID | 10280 |
Full Name | sigma non-opioid intracellular receptor 1 |
Alias | ALS16, DSMA2, OPRS1, SIG-1R, SR-BP |
Species | Human |
Genomic Locus | chr9:34637268 |
Transcript | NM_005866 |
WT Expression Level | 265.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 80bp deletion in a coding exon of SIGMAR1. |
Description | 80bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGGACAGCGAGGCGTGCAGA |
PCR Primer |
Forward: GTGACAATCGCACATGACACTATC Reverse: CCTTCTCTCGTCTGATCGTGGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.