SIGMAR1 Knockout Cell Line - CD BioSciences

service-banner

SIGMAR1 Knockout Cell Line

SIGMAR1 Knockout Cell Line

SPL-03194

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name SIGMAR1
Gene Abbr. SIGMAR1
Gene ID 10280
Full Name sigma non-opioid intracellular receptor 1
Alias ALS16, DSMA2, OPRS1, SIG-1R, SR-BP
Species Human
Genomic Locus chr9:34637268
Transcript NM_005866
WT Expression Level 265.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of SIGMAR1.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence CGGACAGCGAGGCGTGCAGA
PCR Primer Forward: GTGACAATCGCACATGACACTATC
Reverse: CCTTCTCTCGTCTGATCGTGGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.