Online Inquiry
SHMT1 Knockout Cell Line
SPL-03190
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | SHMT1 |
| Gene Abbr. | SHMT1 |
| Gene ID | 6470 |
| Full Name | serine hydroxymethyltransferase 1 |
| Alias | CSHMT, SHMT |
| Species | Human |
| Genomic Locus | chr17:18347581 |
| Transcript | NM_004169 |
| WT Expression Level | 44.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the cytosolic form of serine hydroxymethyltransferase, a pyridoxal phosphate-containing enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. This reaction provides one-carbon units for synthesis of methionine, thymidylate, and purines in the cytoplasm. This gene is located within the Smith-Magenis syndrome region on chromosome 17. A pseudogene of this gene is located on the short arm of chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of SHMT1. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATGGGCCTGGACCTTCCGGA |
| PCR Primer |
Forward: AGAGGTTTCCCAAGGAAATAAAAGC Reverse: CTCTCTCTGAACTTCACCTCTCAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.