SHCBP1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SHCBP1 cDNA ORF Clone, Human, untagged

SHCBP1 cDNA ORF Clone, Human, untagged

SPD-13631

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SHC SH2-domain binding protein 1.
Target Information
Species Human
Target Name SHCBP1
Gene Abbr. SHCBP1
Gene ID 79801
Full Name SHC binding and spindle associated 1
Alias PAL
Product Details
Description Full length Clone DNA of Human SHC SH2-domain binding protein 1.
NCBI Ref Seq BC030699
RefSeq ORF Size 2019 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.