SHC3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SHC3 cDNA ORF Clone, Human, untagged

SHC3 cDNA ORF Clone, Human, untagged

SPD-13611

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SHC (Src homology 2 domain containing) transforming protein 3
Target Information
Species Human
Target Name Shc
Gene Abbr. SHC3
Gene ID 53358
Full Name SHC adaptor protein 3
Alias N-Shc, NSHC, RAI, SHCC
Product Details
Description Full length Clone DNA of Human SHC (Src homology 2 domain containing) transforming protein 3
NCBI Ref Seq NM_016848.5
RefSeq ORF Size 1785 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites HindIII + NotI (6.1kb + 1.79kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.