SHC1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SHC1 cDNA ORF Clone, Human, untagged

SHC1 cDNA ORF Clone, Human, untagged

SPD-13609

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SHC adaptor protein 1.
Target Information
Species Human
Target Name Shc
Gene Abbr. SHC1
Gene ID 6464
Full Name SHC adaptor protein 1
Alias SHC, SHCA
Introduction Shc possesses SH2 and PTB domains and serves as a scaffold protein in signaling for a variety of receptor tyrosine kinases. Shc exists in p46, p52 and p66 isoforms, which are produced by using alternative translation initiation sites or a differentially spliced message. In response to extracellular signals, the SH2 and PTB domains of Shc interact with the activated receptors, leading to phosphorylation of Shc on three different tyrosine residues: Tyr239, Tyr240 and Tyr317. GRB2/Sos binds to Shc phosphorylated at these sites, activating the Ras/Raf/MAPK pathway. Both Shc expression and its tyrosine phosphorylation play an essential and nonredundant role in thymic T cell development.
Product Details
Description Full length Clone DNA of Human SHC adaptor protein 1.
NCBI Ref Seq NM_183001.4
RefSeq ORF Size 1752 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.43kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.