Online Inquiry
SHC1 cDNA ORF Clone, Human, N-His tag
SPD-13605
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2 with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Shc |
Gene Abbr. | SHC1 |
Gene ID | 6464 |
Full Name | SHC adaptor protein 1 |
Alias | SHC, SHCA |
Introduction | Shc possesses SH2 and PTB domains and serves as a scaffold protein in signaling for a variety of receptor tyrosine kinases. Shc exists in p46, p52 and p66 isoforms, which are produced by using alternative translation initiation sites or a differentially spliced message. In response to extracellular signals, the SH2 and PTB domains of Shc interact with the activated receptors, leading to phosphorylation of Shc on three different tyrosine residues: Tyr239, Tyr240 and Tyr317. GRB2/Sos binds to Shc phosphorylated at these sites, activating the Ras/Raf/MAPK pathway. Both Shc expression and its tyrosine phosphorylation play an essential and nonredundant role in thymic T cell development. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2 with N terminal His tag. |
NCBI Ref Seq | NM_003029.3 |
RefSeq ORF Size | 1425 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.