SH3GLB1 Knockout Cell Line - CD BioSciences

service-banner

SH3GLB1 Knockout Cell Line

SH3GLB1 Knockout Cell Line

SPL-03184

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name SH3GLB1
Gene Abbr. SH3GLB1
Gene ID 51100
Full Name SH3 domain containing GRB2 like, endophilin B1
Alias Bif-1, CGI-61, PPP1R70, dJ612B15.2
Species Human
Genomic Locus chr1:86734652
Transcript NM_016009
WT Expression Level 33.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of SH3GLB1.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence GATTACCAGACTTCTGCTAG
PCR Primer Forward: ATTATAACTTGAGGTTTGTTCGGGG
Reverse: GGGAGAACTCGGTGATAAGATGTAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.