Online Inquiry
SGK3 Knockout Cell Line
SPL-03175
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | SGK3 |
Gene Abbr. | SGK3 |
Gene ID | 23678 |
Full Name | serum/glucocorticoid regulated kinase family member 3 |
Alias | CISK, SGK2, SGKL |
Species | Human |
Genomic Locus | chr8:66804393 |
Transcript | NM_013257 |
WT Expression Level | 11.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is a member of the Ser/Thr protein kinase family and encodes a phosphoprotein with a PX (phox homology) domain. The protein phosphorylates several target proteins and has a role in neutral amino acid transport and activation of potassium and chloride channels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SGK3. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GGAATCTTCAGGGCCATAGC |
PCR Primer |
Forward: ACCCACCTCACGAAGTTGTC Reverse: ACCCACCTCACGAAGTTGTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.