Online Inquiry
SGF29 Knockout Cell Line
SPL-03174
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 206bp insertion |
| Target Information | |
|---|---|
| Target Name | SGF29 |
| Gene Abbr. | SGF29 |
| Gene ID | 112869 |
| Full Name | SAGA complex associated factor 29 |
| Alias | CCDC101, STAF36, TDRD29 |
| Species | Human |
| Genomic Locus | chr16:28585656 |
| Transcript | NM_138414 |
| Introduction | CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 206bp insertion in a coding exon of CCDC101. |
| Description | 206bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGCAGCTTTGTCCGGTAATA |
| PCR Primer |
Forward: ATGTAGGGATGGCATTTGTACCATA Reverse: TAGCAATCAGCTTATCCATGGGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.