Online Inquiry
SETMAR Knockout Cell Line
SPL-03169
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | SETMAR |
| Gene Abbr. | SETMAR |
| Gene ID | 6419 |
| Full Name | SET domain and mariner transposase fusion gene |
| Alias | METNASE, Mar1 |
| Species | Human |
| Genomic Locus | chr3:4312904 |
| Transcript | NM_006515 |
| WT Expression Level | 34.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a fusion protein that contains an N-terminal histone-lysine N-methyltransferase domain and a C-terminal mariner transposase domain. The encoded protein binds DNA and functions in DNA repair activities including non-homologous end joining and double strand break repair. The SET domain portion of this protein specifically methylates histone H3 lysines 4 and 36. This gene exists as a fusion gene only in anthropoid primates, other organisms lack mariner transposase domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of SETMAR. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGATCATGTAGTTGGACC |
| PCR Primer |
Forward: TGTGTTTTGACAGTTTTGTCCTGTT Reverse: TTCAAAAACAGGCTCTGCATACTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.