Online Inquiry
SETDB1 Knockout Cell Line
SPL-03168
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | ESET |
| Gene Abbr. | SETDB1 |
| Gene ID | 9869 |
| Full Name | SET domain bifurcated histone lysine methyltransferase 1 |
| Alias | ESET, H3-K9-HMTase4, KG1T, KMT1E, TDRD21 |
| Species | Human |
| Genomic Locus | chr1:150930009 |
| Transcript | NM_001145415 |
| WT Expression Level | 22.26 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of SETDB1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAAGCTGGGACTACAATACC |
| PCR Primer |
Forward: GGGCTTACTTTGGATTTTTGAGGAA Reverse: AAAGCTCATCCCTTACCTGAATCAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.