Online Inquiry
SENP3 Knockout Cell Line
SPL-03155
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | SENP3 |
| Gene Abbr. | SENP3 |
| Gene ID | 26168 |
| Full Name | SUMO specific peptidase 3 |
| Alias | SMT3IP1, SSP3, Ulp1 |
| Species | Human |
| Genomic Locus | chr17:7563192 |
| Transcript | NM_015670 |
| WT Expression Level | 140.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of SENP3. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCTGACTTGAGTCGGGGTT |
| PCR Primer |
Forward: TGTTTTTCAGGGTACTGGAAGATGA Reverse: GTGAGCAGGTTTTTCGATGAGTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.