Online Inquiry
SCYL3 Knockout Cell Line
SPL-03147
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | SCYL3 |
| Gene Abbr. | SCYL3 |
| Gene ID | 57147 |
| Full Name | SCY1 like pseudokinase 3 |
| Alias | PACE-1, PACE1 |
| Species | Human |
| Genomic Locus | chr1:169873700 |
| Transcript | NM_020423 |
| WT Expression Level | 3.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SCYL3. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTTCAGGAGGGATAGATGC |
| PCR Primer |
Forward: AAGAAAGGAGTAAGCAGAGGAAAGT Reverse: TATGCGGCATTGATTTGAAGGTTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.