Online Inquiry
SCN1B Knockout Cell Line
SPL-03143
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | SCN1B |
| Gene Abbr. | SCN1B |
| Gene ID | 6324 |
| Full Name | sodium voltage-gated channel beta subunit 1 |
| Alias | ATFB13, BRGDA5, DEE52, EIEE52, GEFSP1 |
| Species | Human |
| Genomic Locus | chr19:35032636 |
| Transcript | NM_001037 |
| WT Expression Level | 2.12 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Voltage-gated sodium channels are heteromeric proteins that function in the generation and propagation of action potentials in muscle and neuronal cells. They are composed of one alpha and two beta subunits, where the alpha subunit provides channel activity and the beta-1 subunit modulates the kinetics of channel inactivation. This gene encodes a sodium channel beta-1 subunit. Mutations in this gene result in generalized epilepsy with febrile seizures plus, Brugada syndrome 5, and defects in cardiac conduction. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of SCN1B. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTCGGTGAAGGTCTCAGCGT |
| PCR Primer |
Forward: AACAGATGGTTTGTGAGGGGTC Reverse: GTCTTCCCTCCGTAATGACTATCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.