Online Inquiry
SCML2 Knockout Cell Line
SPL-03140
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | SCML2 |
| Gene Abbr. | SCML2 |
| Gene ID | 10389 |
| Full Name | Scm polycomb group protein like 2 |
| Species | Human |
| Genomic Locus | chrX:18323962 |
| Transcript | NM_006089 |
| WT Expression Level | 22.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the Polycomb group proteins. These proteins form the Polycomb repressive complexes which are involved in transcriptional repression. The encoded protein binds histone peptides that are monomethylated at lysine residues and may be involved in regulating homeotic gene expression during development. [provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SCML2. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCCAGTCGTAACCGTAACC |
| PCR Primer |
Forward: AGGCCACTTAAAGCCATTTCTATTG Reverse: AAATGTTCCTCAGGTATTCTGGTGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.