Online Inquiry
S1PR1 Knockout Cell Line
SPL-03123
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | S1P1/EDG-1 |
| Gene Abbr. | S1PR1 |
| Gene ID | 1901 |
| Full Name | sphingosine-1-phosphate receptor 1 |
| Alias | CD363, CHEDG1, D1S3362, ECGF1, EDG-1 |
| Species | Human |
| Genomic Locus | chr1:101239086 |
| Transcript | NM_001400 |
| WT Expression Level | 1.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is structurally similar to G protein-coupled receptors and is highly expressed in endothelial cells. It binds the ligand sphingosine-1-phosphate with high affinity and high specificity, and suggested to be involved in the processes that regulate the differentiation of endothelial cells. Activation of this receptor induces cell-cell adhesion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of S1PR1. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGAATATCAGCGCGGACA |
| PCR Primer |
Forward: CTCTAGCGTTCGTCTGGAGTAG Reverse: GGAATTTCTTGGTTTTCCAAATGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.