Online Inquiry
RYR2 Knockout Cell Line
SPL-03114
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp insertion |
Target Information | |
---|---|
Target Name | RYR2 |
Gene Abbr. | RYR2 |
Gene ID | 6262 |
Full Name | ryanodine receptor 2 |
Alias | ARVC2, ARVD2, RYR-2, RyR, VTSIP |
Species | Human |
Genomic Locus | chr1:237369566 |
Transcript | NM_001035 |
WT Expression Level | 2.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of RYR2. |
Description | 2bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCAATATGGCATGTCCGTAG |
PCR Primer |
Forward: TACTAACGTTCCTTTGAGAGCAAGA Reverse: AAGAACACAAACATCCAAGCTCATT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.