Online Inquiry
RXRB Knockout Cell Line
SPL-03111
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | RXRB |
| Gene Abbr. | RXRB |
| Gene ID | 6257 |
| Full Name | retinoid X receptor beta |
| Alias | DAUDI6, H-2RIIBP, NR2B2, RCoR-1 |
| Species | Human |
| Genomic Locus | chr6:33200296 |
| Transcript | NM_021976 |
| WT Expression Level | 15.41 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of RXRB. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGCGGAGAACAACAAACCC |
| PCR Primer |
Forward: GTGTTTACAAACAAGGGGGCG Reverse: GACCTCTTCGGTATCCCTACTCTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.