RXRA Knockout Cell Line - CD BioSciences

service-banner

RXRA Knockout Cell Line

RXRA Knockout Cell Line

SPL-03109

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name RARα
Gene Abbr. RXRA
Gene ID 6256
Full Name retinoid X receptor alpha
Alias NR2B1
Species Human
Genomic Locus chr9:134401774
Transcript NM_002957
WT Expression Level 19.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of RXRA.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GCGGGCCCATGCCGTTGATG
PCR Primer Forward: GATTTCTCCACCCAGGTGAACT
Reverse: GGCTCTGTATACTCTGCGTCAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.