Online Inquiry
RXRA Knockout Cell Line
SPL-03108
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 280bp insertion |
| Target Information | |
|---|---|
| Target Name | RARα |
| Gene Abbr. | RXRA |
| Gene ID | 6256 |
| Full Name | retinoid X receptor alpha |
| Alias | NR2B1 |
| Species | Human |
| Genomic Locus | chr9:134401774 |
| Transcript | NM_002957 |
| WT Expression Level | 19.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 280bp insertion in a coding exon of RXRA. |
| Description | 280bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCGGGCCCATGCCGTTGATG |
| PCR Primer |
Forward: GATTTCTCCACCCAGGTGAACT Reverse: GGCTCTGTATACTCTGCGTCAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.