RTN4 Knockout Cell Line - CD BioSciences

service-banner

RTN4 Knockout Cell Line

RTN4 Knockout Cell Line

SPL-03105

Size Price
1 Unit Online Inquiry
Description
67bp deletion
Target Information
Target Name RTN4
Gene Abbr. RTN4
Gene ID 57142
Full Name reticulon 4
Alias ASY, NI220/250, NOGO, NSP, NSP-CL
Species Human
Genomic Locus chr2:54987498
Transcript NM_153828
WT Expression Level 148.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 67bp deletion in a coding exon of RTN4.
Description 67bp deletion
Parental Cell Line C631
Guide RNA Sequence GGTGGCCTTCATCTGATTTC
PCR Primer Forward: CTCCTCCATCATGAGCCTTTAAAAC
Reverse: GAGACATTAAGAAGACTGGAGTGGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.