Online Inquiry
RTN4 Knockout Cell Line
SPL-03104
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 67bp deletion |
| Target Information | |
|---|---|
| Target Name | RTN4 |
| Gene Abbr. | RTN4 |
| Gene ID | 57142 |
| Full Name | reticulon 4 |
| Alias | ASY, NI220/250, NOGO, NSP, NSP-CL |
| Species | Human |
| Genomic Locus | chr2:54987579 |
| Transcript | NM_153828 |
| WT Expression Level | 148.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 67bp deletion in a coding exon of RTN4. |
| Description | 67bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTAACAGCCTACATTGCCT |
| PCR Primer |
Forward: ATCCTGTTTACACTATTGCCAATGC Reverse: GCGTTTTTGTTTTCATAGATGGAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.