Online Inquiry
RPTOR cDNA ORF Clone, Human, untagged
SPD-13047
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human regulatory associated protein of MTOR, complex 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Raptor |
| Gene Abbr. | RPTOR |
| Gene ID | 57521 |
| Full Name | regulatory associated protein of MTOR complex 1 |
| Alias | KOG1, Mip1 |
| Introduction | The regulatory associated protein of mTOR (Raptor) was identified as an mTOR binding partner that mediates mTOR signaling to downstream targets. Raptor binds to mTOR substrates, including 4E-BP1 and p70 S6 kinase, through their TOR signaling (TOS) motifs and is required for mTOR-mediated phosphorylation of these substrates. Binding of the FKBP12-rapamycin complex to mTOR inhibits the mTOR-raptor interaction, suggesting a mechanism for rapamycin's specific inhibition of mTOR signaling. This mTOR-raptor interaction and its regulation by nutrients and/or rapamycin is dependent on a protein called GβL. GβL is also part of the rapamycin-insensitive complex between mTOR and rictor (rapamycin-insensitive companion of mTOR), and may mediate rictor-mTOR signaling to downstream targets including PKCα. Furthermore, the rictor-mTOR complex has been identified as the previously elusive PDK2 responsible for the phosphorylation of Akt/PKB on Ser473, facilitating phosphorylation of Akt/PKB on Thr308 by PDK1 and required for the full activation of Akt/PKB.Recently raptor has been identified as a direct substrate of the AMP-activated protein kinase (AMPK). AMPK phosphorylates raptor on Ser722/Ser792. This phosphorylation is essential for inhibition of the raptor-containing mTOR complex 1 (mTORC1) and induces cell cycle arrest when cells are stressed for energy. These findings suggest that raptor is a critical switch that correlates cell cycle progression with energy status. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human regulatory associated protein of MTOR, complex 1. |
| NCBI Ref Seq | NM_020761.2 |
| RefSeq ORF Size | 4008 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1269C/T,2337G/A,2526C/T,3231C/T not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 4.01kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.