RPS6KB1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

RPS6KB1 cDNA ORF Clone, Human, N-HA tag

RPS6KB1 cDNA ORF Clone, Human, N-HA tag

SPD-11043

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal HA tag.
Target Information
Species Human
Target Name p70 S6K
Gene Abbr. RPS6KB1
Gene ID 6198
Full Name ribosomal protein S6 kinase B1
Alias PS6K, S6K, S6K-beta-1, S6K1, STK14A
Introduction p70 S6 kinase is a mitogen activated Ser/Thr protein kinase that is required for cell growth and G1 cell cycle progression. p70 S6 kinase phosphorylates the S6 protein of the 40S ribosomal subunit and is involved in translational control of 5' oligopyrimidine tract mRNAs. A second isoform, p85 S6 kinase, is derived from the same gene and is identical to p70 S6 kinase except for 23 extra residues at the amino terminus, which encode a nuclear localizing signal. Both isoforms lie on a mitogen activated signaling pathway downstream of phosphoinositide-3 kinase (PI-3K) and the target of rapamycin, FRAP/mTOR, a pathway distinct from the Ras/MAP kinase cascade. The activity of p70 S6 kinase is controlled by multiple phosphorylation events located within the catalytic, linker and pseudosubstrate domains. Phosphorylation of Thr229 in the catalytic domain and Thr389 in the linker domain are most critical for kinase function. Phosphorylation of Thr389, however, most closely correlates with p70 kinase activity in vivo. Prior phosphorylation of Thr389 is required for the action of phosphoinositide 3-dependent protein kinase 1 (PDK1) on Thr229. Phosphorylation of this site is stimulated by growth factors such as insulin, EGF and FGF, as well as by serum and some G-protein-coupled receptor ligands, and is blocked by wortmannin, LY294002 (PI-3K inhibitor) and rapamycin (FRAP/mTOR inhibitor). Ser411, Thr421 and Ser424 lie within a Ser-Pro-rich region located in the pseudosubstrate region. Phosphorylation at these sites is thought to activate p70 S6 kinase via relief of pseudosubstrate suppression. Another LY294002 and rapamycin sensitive phosphorylation site, Ser371, is an in vitro substrate for mTOR and correlates well with the activity of a partially rapamycin resistant mutant p70 S6 kinase.
Product Details
Description Full length Clone DNA of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal HA tag.
NCBI Ref Seq NM_003161.2
RefSeq ORF Size 1620 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.62kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.