Online Inquiry
RPS6KA6 Knockout Cell Line
SPL-03098
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | p90RSK |
| Gene Abbr. | RPS6KA6 |
| Gene ID | 27330 |
| Full Name | ribosomal protein S6 kinase A6 |
| Alias | PP90RSK4, RSK-4, RSK4, S6K-alpha-6, p90RSK6 |
| Species | Human |
| Genomic Locus | chrX:84135156 |
| Transcript | NM_014496 |
| WT Expression Level | 1.28 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of ribosomal S6 kinase family, serine-threonine protein kinases which are regulated by growth factors. The encoded protein may be distinct from other members of this family, however, as studies suggest it is not growth factor dependent and may not participate in the same signaling pathways. [provided by RefSeq, Jan 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of RPS6KA6. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGCAGAACTGGCCCTTGCTT |
| PCR Primer |
Forward: TGCCAATAATTATGCCAGTCA Reverse: TTTCATCAAGCAAAATGCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.