RPS6KA6 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

RPS6KA6 cDNA ORF Clone, Human, C-HA tag

RPS6KA6 cDNA ORF Clone, Human, C-HA tag

SPD-11070

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) with C terminal HA tag.
Target Information
Species Human
Target Name p90RSK
Gene Abbr. RPS6KA6
Gene ID 27330
Full Name ribosomal protein S6 kinase A6
Alias PP90RSK4, RSK-4, RSK4, S6K-alpha-6, p90RSK6
Introduction The 90 kDa ribosomal S6 kinases (RSK1-4) are a family of widely expressed Ser/Thr kinases characterized by two nonidentical, functional kinase domains and a carboxy-terminal docking site for extracellular signal-regulated kinases (ERKs). Several sites both within and outside of the RSK kinase domain, including Ser380, Thr359, Ser363, and Thr573, are important for kinase activation. RSK1-3 are activated via coordinated phosphorylation by MAPKs, autophosphorylation, and phosphoinositide-3-OH kinase (PI3K) in response to many growth factors, polypeptide hormones, and neurotransmitters.Upon mitogenic stimulation, p44/42 Erk1/2 and Erk5 MAP kinases cooperatively phosphorylate p90RSK at Thr573 (p90RSK1 numbering) located within the C-terminal kinase domain and at Thr359/Ser363 in the linker region between the two kinase domains. Phosphorylation at Thr573 within the activation loop of the p90RSK C-terminal kinase domain promotes activation and directs phosphorylation at Ser380 within the hydrophobic stretch of the linker region. When phosphorylated, Ser380 acts as a docking site for the constitutively active Ser/Thr kinase PDK1, which in turn phosphorylates p90RSK at Ser221 within the N-terminal kinase domain activation loop, resulting in full enzymatic activation of p90RSK. Antibodies against these phosphorylation sites are useful for understanding the kinetics and regulation of p90RSK activation.
Product Details
Description Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) with C terminal HA tag.
NCBI Ref Seq NM_014496.2
RefSeq ORF Size 2238 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.