Online Inquiry
RPS6KA5 cDNA ORF Clone, Human, untagged
SPD-11066
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 5, transcript variant 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | p90RSK |
| Gene Abbr. | RPS6KA5 |
| Gene ID | 9252 |
| Full Name | ribosomal protein S6 kinase A5 |
| Alias | MSK1, MSPK1, RLPK |
| Introduction | MSK1, a mitogen and stress activated protein kinase, is activated by Erk as well as p38 MAPK in response to growth factors and cellular stress, respectively. MSK1 resembles RSK because it has two kinase domains connected by a regulatory linker region. Phosphorylation of RSK1 at Ser364 and Ser381 is critical for RSK1 activity. These sites are analogous to Ser360 and Ser376 of MSK1, which may be important for MSK1 activity as well. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 5, transcript variant 1. |
| NCBI Ref Seq | NM_004755.2 |
| RefSeq ORF Size | 2409 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.41kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.