RPS6KA4 Knockout Cell Line - CD BioSciences

service-banner

RPS6KA4 Knockout Cell Line

RPS6KA4 Knockout Cell Line

SPL-03095

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name p90RSK
Gene Abbr. RPS6KA4
Gene ID 8986
Full Name ribosomal protein S6 kinase A4
Alias MSK2, RSK-B, S6K-alpha-4
Species Human
Genomic Locus chr11:64360181
Transcript NM_003942
WT Expression Level 12.35 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and ATF1. The encoded protein can also phosphorylate histone H3 to regulate certain inflammatory genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of RPS6KA4.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CCCGCCCGCCTTCCGCACCA
PCR Primer Forward: GCTGGTAGAGGTGGGTGAAC
Reverse: ATCCTTTCCCTGGTTTTGCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.