Online Inquiry
RPS6KA1 Knockout Cell Line
SPL-03092
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | p90RSK |
| Gene Abbr. | RPS6KA1 |
| Gene ID | 6195 |
| Full Name | ribosomal protein S6 kinase A1 |
| Alias | HU-1, MAPKAPK1, MAPKAPK1A, RSK, RSK1 |
| Species | Human |
| Genomic Locus | chr1:26546894 |
| Transcript | NM_002953 |
| WT Expression Level | 38.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 nonidentical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of RPS6KA1. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCACGCACCACGTCAAGGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTATCGTGAGCAATAGGAGCGG Reverse: TGGGAGAGGTCTGAGTCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.