RPS6KA1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RPS6KA1 cDNA ORF Clone, Human, untagged

RPS6KA1 cDNA ORF Clone, Human, untagged

SPD-11055

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ribosomal protein S6 kinase A1.
Target Information
Species Human
Target Name p90RSK
Gene Abbr. RPS6KA1
Gene ID 6195
Full Name ribosomal protein S6 kinase A1
Alias HU-1, MAPKAPK1, MAPKAPK1A, RSK, RSK1
Introduction The 90 kDa ribosomal S6 kinases (RSK1-4) are a family of widely expressed Ser/Thr kinases characterized by two nonidentical, functional kinase domains and a carboxy-terminal docking site for extracellular signal-regulated kinases (ERKs). Several sites both within and outside of the RSK kinase domain, including Ser380, Thr359, Ser363, and Thr573, are important for kinase activation. RSK1-3 are activated via coordinated phosphorylation by MAPKs, autophosphorylation, and phosphoinositide-3-OH kinase (PI3K) in response to many growth factors, polypeptide hormones, and neurotransmitters.PI3K-induced activation of RSK1 is mediated by the Ser/Thr kinase mTOR (mammalian target of rapamycin). This activation of RSK1 selectively increases the translation of mRNA transcripts containing a tract of pyrimidine (TOP) motif. An association between RSK1 and specific PKA subunits depends upon RSK1 activation state and determines both intracellular localization and specific activity of the kinase. Evidence from animal models suggests that RSK1 is a key regulator of glucose homeostasis and cell size.
Product Details
Description Full length Clone DNA of Human ribosomal protein S6 kinase A1.
NCBI Ref Seq NM_002953.3
RefSeq ORF Size 2208 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 51T/G,1398T/C not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.21kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.