Online Inquiry
RPS6KA1 cDNA ORF Clone, Human, untagged
SPD-11055
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human ribosomal protein S6 kinase A1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | p90RSK |
| Gene Abbr. | RPS6KA1 |
| Gene ID | 6195 |
| Full Name | ribosomal protein S6 kinase A1 |
| Alias | HU-1, MAPKAPK1, MAPKAPK1A, RSK, RSK1 |
| Introduction | The 90 kDa ribosomal S6 kinases (RSK1-4) are a family of widely expressed Ser/Thr kinases characterized by two nonidentical, functional kinase domains and a carboxy-terminal docking site for extracellular signal-regulated kinases (ERKs). Several sites both within and outside of the RSK kinase domain, including Ser380, Thr359, Ser363, and Thr573, are important for kinase activation. RSK1-3 are activated via coordinated phosphorylation by MAPKs, autophosphorylation, and phosphoinositide-3-OH kinase (PI3K) in response to many growth factors, polypeptide hormones, and neurotransmitters.PI3K-induced activation of RSK1 is mediated by the Ser/Thr kinase mTOR (mammalian target of rapamycin). This activation of RSK1 selectively increases the translation of mRNA transcripts containing a tract of pyrimidine (TOP) motif. An association between RSK1 and specific PKA subunits depends upon RSK1 activation state and determines both intracellular localization and specific activity of the kinase. Evidence from animal models suggests that RSK1 is a key regulator of glucose homeostasis and cell size. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human ribosomal protein S6 kinase A1. |
| NCBI Ref Seq | NM_002953.3 |
| RefSeq ORF Size | 2208 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 51T/G,1398T/C not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.21kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.