Rps6 cDNA ORF Clone, Rat, C-His tag - CD BioSciences

service-banner

Rps6 cDNA ORF Clone, Rat, C-His tag

Rps6 cDNA ORF Clone, Rat, C-His tag

SPD-13487

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat 40S ribosomal protein S6-like with C terminal His tag.
Target Information
Species Rat
Target Name S6 Ribosomal Protein
Gene Abbr. Rps6
Gene ID 29304
Full Name ribosomal protein S6
Introduction One way that growth factors and mitogens effectively promote sustained cell growth and proliferation is by upregulating mRNA translation. Growth factors and mitogens induce the activation of p70 S6 kinase and the subsequent phosphorylation of the S6 ribosomal protein. Phosphorylation of S6 ribosomal protein correlates with an increase in translation of mRNA transcripts that contain an oligopyrimidine tract in their 5' untranslated regions. These particular mRNA transcripts (5'TOP) encode proteins involved in cell cycle progression, as well as ribosomal proteins and elongation factors necessary for translation. Important S6 ribosomal protein phosphorylation sites include several residues (Ser235, Ser236, Ser240, and Ser244) located within a small, carboxy-terminal region of the S6 protein.
Product Details
Description Full length Clone DNA of Rat 40S ribosomal protein S6-like with C terminal His tag.
NCBI Ref Seq XM_003749971.1
RefSeq ORF Size 750 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.