Online Inquiry
RPS6 cDNA ORF Clone, Human, C-FLAG tag
SPD-13516
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human ribosomal protein S6 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | S6 Ribosomal Protein |
Gene Abbr. | RPS6 |
Gene ID | 6194 |
Full Name | ribosomal protein S6 |
Alias | S6 |
Introduction | One way that growth factors and mitogens effectively promote sustained cell growth and proliferation is by upregulating mRNA translation. Growth factors and mitogens induce the activation of p70 S6 kinase and the subsequent phosphorylation of the S6 ribosomal protein. Phosphorylation of S6 ribosomal protein correlates with an increase in translation of mRNA transcripts that contain an oligopyrimidine tract in their 5' untranslated regions. These particular mRNA transcripts (5'TOP) encode proteins involved in cell cycle progression, as well as ribosomal proteins and elongation factors necessary for translation. Important S6 ribosomal protein phosphorylation sites include several residues (Ser235, Ser236, Ser240, and Ser244) located within a small, carboxy-terminal region of the S6 protein. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human ribosomal protein S6 with C terminal Flag tag. |
NCBI Ref Seq | NM_001010.2 |
RefSeq ORF Size | 789 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.79kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.