Online Inquiry
ROR2 cDNA ORF Clone, Human, N-HA tag
SPD-13452
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human receptor tyrosine kinase-like orphan receptor 2 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | ROR2 |
Gene Abbr. | ROR2 |
Gene ID | 4920 |
Full Name | receptor tyrosine kinase like orphan receptor 2 |
Alias | BDB, BDB1, NTRKR2 |
Introduction | ROR1 and ROR2 are orphan receptor tyrosine kinases that are most closely related to MuSK and the Trk family of neurotrophin receptors. They are characterized by the presence of extracellular frizzled-like cysteine-rich domains and membrane-proximal kringle domains, both of which are assumed to mediate protein-protein interactions. The ROR family RTKs are evolutionarily conserved among Caenorhabditis elegans, Drosophila, mice, and humans. Although the functions of ROR kinases are unknown, similarities between ROR and MuSK and Trk kinases have led to speculation that ROR kinases regulate synaptic development. CAM-1, a C. elegans ortholog of the ROR family RTKs, plays several important roles in regulating cellular migration, polarity of asymmetric cell divisions, and axonal outgrowth of neurons during nematode development. mROR1 and mROR2 may play differential roles during the development of the nervous system. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human receptor tyrosine kinase-like orphan receptor 2 with N terminal HA tag. |
NCBI Ref Seq | NM_004560.3 |
RefSeq ORF Size | 2825 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 269C/T,2081C/T not causing the amino acid variation. |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + XbaI (6kb + 2.83kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.