ROR2 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

ROR2 cDNA ORF Clone, Human, C-HA tag

ROR2 cDNA ORF Clone, Human, C-HA tag

SPD-13447

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human receptor tyrosine kinase-like orphan receptor 2 with C terminal HA tag.
Target Information
Species Human
Target Name ROR2
Gene Abbr. ROR2
Gene ID 4920
Full Name receptor tyrosine kinase like orphan receptor 2
Alias BDB, BDB1, NTRKR2
Introduction ROR1 and ROR2 are orphan receptor tyrosine kinases that are most closely related to MuSK and the Trk family of neurotrophin receptors. They are characterized by the presence of extracellular frizzled-like cysteine-rich domains and membrane-proximal kringle domains, both of which are assumed to mediate protein-protein interactions. The ROR family RTKs are evolutionarily conserved among Caenorhabditis elegans, Drosophila, mice, and humans. Although the functions of ROR kinases are unknown, similarities between ROR and MuSK and Trk kinases have led to speculation that ROR kinases regulate synaptic development. CAM-1, a C. elegans ortholog of the ROR family RTKs, plays several important roles in regulating cellular migration, polarity of asymmetric cell divisions, and axonal outgrowth of neurons during nematode development. mROR1 and mROR2 may play differential roles during the development of the nervous system.
Product Details
Description Full length Clone DNA of Human receptor tyrosine kinase-like orphan receptor 2 with C terminal HA tag.
NCBI Ref Seq NM_004560.3
RefSeq ORF Size 2874 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 276C/T,2088C/T not causing the amino acid variation.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 2.87kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.