Online Inquiry
ROR1 Knockout Cell Line
SPL-03080
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
10bp deletion |
Target Information | |
---|---|
Target Name | ROR1 |
Gene Abbr. | ROR1 |
Gene ID | 4919 |
Full Name | receptor tyrosine kinase like orphan receptor 1 |
Alias | NTRKR1, dJ537F10.1 |
Species | Human |
Genomic Locus | chr1:64009340 |
Transcript | NM_001083592 |
WT Expression Level | 0.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ROR1. |
Description | 10bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GAGATGTTCCATGATGAGGT |
PCR Primer |
Forward: CTGGCCAATAGATTGTTCATTTGGA Reverse: TTGCAGTGATCTGAAAAACAGTTGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.