Online Inquiry
ROCK2 Knockout Cell Line
SPL-03078
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | ROCK2 |
| Gene Abbr. | ROCK2 |
| Gene ID | 9475 |
| Full Name | Rho associated coiled-coil containing protein kinase 2 |
| Alias | ROCK-II |
| Species | Human |
| Genomic Locus | chr2:11235803 |
| Transcript | NM_004850 |
| WT Expression Level | 12.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of ROCK2. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTGGATGCAATACACTCCA |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGGCAGAAGTAACAATGGTGGTGAAAA Reverse: CTGGTGGAGACCTTGTAAACCTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.