Online Inquiry
RNF8 Knockout Cell Line
SPL-03071
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 152bp insertion |
| Target Information | |
|---|---|
| Target Name | RNF8 |
| Gene Abbr. | RNF8 |
| Gene ID | 9025 |
| Full Name | ring finger protein 8 |
| Alias | hRNF8 |
| Species | Human |
| Genomic Locus | chr6:37354171 |
| Transcript | NM_003958 |
| WT Expression Level | 55.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene contains a RING finger motif and an FHA domain. This protein has been shown to interact with several class II ubiquitin-conjugating enzymes (E2), including UBE2E1/UBCH6, UBE2E2, and UBE2E3, and may act as an ubiquitin ligase (E3) in the ubiquitination of certain nuclear proteins. This protein is also known to play a role in the DNA damage response and depletion of this protein causes cell growth inhibition and cell cycle arrest. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 152bp insertion in a coding exon of RNF8. |
| Description | 152bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGCCCGGCTTCTTCGTCAC |
| PCR Primer |
Forward: CATTCATTCAGCCCAGCAAGAC Reverse: TGGCGATTGCTTCTGTCTGTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.