Online Inquiry
RNF2 Knockout Cell Line
SPL-03062
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
553bp insertion |
Target Information | |
---|---|
Target Name | RNF2 |
Gene Abbr. | RNF2 |
Gene ID | 6045 |
Full Name | ring finger protein 2 |
Alias | BAP-1, BAP1, DING, HIPI3, RING1B |
Species | Human |
Genomic Locus | chr1:185091618 |
Transcript | NM_007212 |
WT Expression Level | 30.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 553bp insertion in a coding exon of RNF2. |
Description | 553bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | AATTCACTGTGTAGACTTCG |
PCR Primer |
Forward: ATTTTTATAACAGTGGTGGTGAGGC Reverse: ACAACTCTTTTCAACATACCCACTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.