Online Inquiry
RNF111 Knockout Cell Line
SPL-03052
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | RNF111 |
| Gene Abbr. | RNF111 |
| Gene ID | 54778 |
| Full Name | ring finger protein 111 |
| Alias | ARK, hRNF111 |
| Species | Human |
| Genomic Locus | chr15:59031129 |
| Transcript | NM_017610 |
| WT Expression Level | 5.80 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of RNF111. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACACAATTCTGCACATACGA |
| PCR Primer |
Forward: TGAAGAGTGAGATTCCTTCTGATGC Reverse: TCCAAAATGCAGACTAGATGAAGGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.