Rnase4 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Rnase4 cDNA ORF Clone, Mouse, untagged

Rnase4 cDNA ORF Clone, Mouse, untagged

SPD-12055

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse RAB1, member RAS oncogene family.
Target Information
Species Mouse
Target Name RAB1
Gene Abbr. Rnase4
Gene ID 58809
Full Name ribonuclease, RNase A family 4
Alias C730049F20Rik, Rab1
Product Details
Description Full length Clone DNA of Mouse RAB1, member RAS oncogene family.
NCBI Ref Seq NM_008996.3
RefSeq ORF Size 618 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.62kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.