RIPK3 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

RIPK3 cDNA ORF Clone, Human, N-HA tag

RIPK3 cDNA ORF Clone, Human, N-HA tag

SPD-13426

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human receptor-interacting serine-threonine kinase 3 with N terminal HA tag.
Target Information
Species Human
Target Name RIP3
Gene Abbr. RIPK3
Gene ID 11035
Full Name receptor interacting serine/threonine kinase 3
Alias RIP3
Introduction The receptor-interacting protein (RIP) family of serine-threonine kinases (RIP, RIP2, RIP3, and RIP4) are important regulators of cellular stress that trigger pro-survival and inflammatory responses through the activation of NF-κB, as well as pro-apoptotic pathways. In addition to the kinase domain, RIP contains a death domain responsible for interaction with the death domain receptor Fas and recruitment to TNF-R1 through interaction with TRADD. RIP-deficient cells show a failure in TNF-mediated NF-κB activation, making the cells more sensitive to apoptosis. RIP also interacts with TNF-receptor-associated factors (TRAFs) and can recruit IKKs to the TNF-R1 signaling complex via interaction with NEMO, leading to IκB phosphorylation and degradation. Overexpression of RIP induces both NF-κB activation and apoptosis. Caspase-8-dependent cleavage of the RIP death domain can trigger the apoptotic activity of RIP.Receptor-interacting protein 3 (RIP3) was originally found to interact with RIP and the TNF receptor complex to induce apoptosis and activation of NF-κB. Subsequently, it has been shown that the association between RIP and RIP3 is a key component of a signaling pathway that results in programmed necrosis (necroptosis), a necrotic-like cell death induced by TNF in the presence of caspase inhibitors. RIP3 is phosphorylated at Ser227 and targets the phosphorylation of mixed lineage kinase domain-like protein (MLKL), which is critical for necroptosis. In mice, RIP3 is phosphorylated at Thr231 and Ser232, leading to association with MLKL and necroptosis.
Product Details
Description Full length Clone DNA of Human receptor-interacting serine-threonine kinase 3 with N terminal HA tag.
NCBI Ref Seq NM_006871.3
RefSeq ORF Size 1557 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.