Online Inquiry
RIPK2 cDNA ORF Clone, Human, untagged
SPD-13407
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human receptor-interacting serine-threonine kinase 2. |
Target Information | |
---|---|
Species | Human |
Target Name | RIP2 |
Gene Abbr. | RIPK2 |
Gene ID | 8767 |
Full Name | receptor interacting serine/threonine kinase 2 |
Alias | CARD3, CARDIAK, CCK, GIG30, RICK |
Introduction | Receptor Interacting Protein 2 (RIP2) is a serine/threonine kinase with a carboxy-terminal caspase activation and recruitment domain (CARD). Association of RIP2 with the tumor necrosis factor receptor (TNFR) causes activation of NF-κB and induction of apoptosis. Expression of RIP2 is induced in macrophages upon exposure to bacterial cell wall components, such as LPS. RIP2-deficient mouse models demonstrate that this kinase integrates and transduces signals for both the innate and adaptive immune system. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human receptor-interacting serine-threonine kinase 2. |
NCBI Ref Seq | BC004553 |
RefSeq ORF Size | 1623 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.